HOME    COMPANY     PRODUCTS     SERVICES     DOWNLOAD     ORDERING     TECH NOTES     SUPPORT    NEWS 
Home >> Products >> SimVector >> Gateway®Cloning Glossary Terms
SimVector

- Design Gateway® cloning

- Perform BP and LR reactions

SimVector Glossary

Cloning: A process for obtaining genetically identical group of genes, cells or organisms.

Gateway® Cloning: Gateway® cloning is a high throughput technology based on site specific recombination reaction between different attachment sites, such as attP, phage attachment site; attB, bacterial attachment site; attL, left attachment junction and attR, right attachment junction. Using this technology, more than one gene can be transferred in one or more vectors, maintaining the reading frame and orientation.

BP Reaction: It is the first recombination reaction of Gateway cloning. It is a reaction between an expression clone (or an attB-flanked PCR product) and donor vector containing attP sites to create an entry clone (PCR fragment with att B sites + Donor vector Entry Clone).

LR Reaction: Is a recombination reaction between an entry clone (containing attL) and a destination vector (containing attR), mediated by a host of recombination proteins to generate an expression clone (Entry Clone + Destination Vector Expression Clone).

Expression Clone/Vector: The term is generally used for a PCR amplified gene tagged with attB sites used in Gateway® BP reaction. This vector recombines with a donor vector to generate an entry vector.

Donor Vector: It is a vector used in Gateway® system which recombines with an expression vector. The process is called a BP reaction and generates an entry vector.

Entry Vector: The recombinant vector resulting from a Gateway® BP reaction contains the cloned PCR amplified product.

Destination Vector: A vector carrying a ccdB gene and an antibiotic resistance gene which are replaced by the gene of interest. The gene of interest is acquired from an entry vector. This process of transfer from an entry clone to a destination vector occurs in the LR reaction of a Gateway® system generating an expression clone.

att: It stands for attachment site generally present in phage viruses and bacteria.

attB: Stands for bacterial attachment site which helps in site specific recombination and always attaches with the PCR product. It consist of four homologous core sequence of ~25 bp each,

attB1 ACAAGTTTGTACAAAAAAGCAGGCT
attB2 ACCCAGCTTTCTTGTACAAAGTGGT
attB3 ACAACTTTGTATAATAAAGTTG
attB4 ACAACTTTGTATAGAAAAGTTG


Home | All Products | Free Tools | Download | Ordering | AlleleID | Array Designer | Beacon Designer | PrimerPlex | Primer Premier | SimGlycan | SimVector | TMA Foresight | Xpression Primer
Gateway® is a registered trademark of Invitrogen Life Technologies.
Copyright ©1994-2008 PREMIER Biosoft International. All rights reserved.